Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14176A4
Clone ID IST14176A4
Vector VICTR74
Project tigm

Sequence tag IST14176A4HMR1
Sequence
GAACATTGCCTTTGAGGAGGGAGAACTCAACATTTAAAATCAAATTTGTAACATTTATTGACAGAGGTACTGATTTTTAA
TATTTTCCTGTGCCAN
Sequence Type genomic DNA
Unitrap ID UNI28081

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39095626..39095720 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]


Sequence tag IST14176A4BBF1
Sequence
TAGTGTGTGCGAATGTTTTGCCTGCGTGCACATATTTGTATTGTGTGTGCANTGCCCTTGGAATGTANAATANGGTGCTG
GAACCCNNGGAACTGGAGTTACGGATGGTTTTGAGCCNNCCTGTGAATGCTGANTGCNNNNCCNNNGTTGNCTGTGAAAC
CTTCCAAATCATTAAAACGGGTANAAAACCNNNNNNCCCTTGGATGAANTTATAATCACAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14176A4HMF2
Sequence
GTTCCAGTGAAGTTCTAGTGACTATTTAAGAGGATATTGCAATTCCTAATCTGCATACACCAAACACAAGGGCACACAAG
TTCATAAAAGAAACACTACTCCAGCTTAAATCACATACTGGCATCCACACACTGATGGAGGGAGACTGAAGTGCTTCCTC
TCACCAACAGACAAGAACTAAAAAGAGAAATGCTGCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39095430..39095629 200
NO GENE  

 
Come back to gene ENSMUSG00000037386


For any suggestions or comments, please send an email to unitrap@crg.es