Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P149D03
Clone ID P149D03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P149D03
Sequence
GCAGCGGGTCTCAAGAGCCGAGCGCTTTGCAAGGNNCTTCGCGGGTTGTTGCGGCGCCGGGGTCGGTGAGGGTCGACCGG
CTGTGGTCGGGCTGCGGGCGGCTCGGGCAGTTCGCGGGCGCCACAG
Sequence Type mRNA
Unitrap ID UNI10756

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18289196..18289321 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]


SPLK-Sequence tag 5SP149D03
Sequence
CAGTGGATATGGGAAGCGGATGGTAGGAATTTGATAGGCCATCTCNNAGGCTTGCATGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP149D03
Sequence
TGACTCTTGGATGCCAATCACTNNAAGGGCNCCCNNTTCTCTGCTGGCTCAAACTAGACTCCCAGCCTTGTACAGCGGCT
CAGATCCCACTGACCTCCATCACTAACCGAAGACAGATAAAGGCTGGCCCAGCTAGTGCGGCCTTTCAGCTTAGAATAGG
ATTTGCGGGGTNNNAAAGGAATTAATGAGGTCATACTGCCTTTGGGTTGAGCGGGAGGCTGCAGCTGTAGCACTGGCCAT
CCGTTCAGCAAGTAGGAGTTGTTCACATGTTTTGGGTAAGCCCTGTGCCAGGGTCCAGGGGAGCCAGCAGTGGGTCTGAC
TTGCTCACAGTCTAATTGGCAAATCAAAATCTGCATCCATAGGTCCAGTCAGCTGAAGAATAGTGANNNTTACAGGCAGG
AGGGCTACCCTTTGAGCTGTGTTGCCAAACATGTGCANNNNNNNCCACACAGTGGCTGCCTGAATTTTACCNTNNNAGAA
ACATGATTCTGACTGGTTTGCCCAGGTTGNNNNNTCTCTTGGCATCCTTCCCCTCCNNNNGGANNNNNATGACTTTTCCC
GTCCNNNNNCCTTTGCCTTCTTCCATGACTCCCATCTCCAGGAATGCCTGCCCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022718


For any suggestions or comments, please send an email to unitrap@crg.es