Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12606C4
Clone ID IST12606C4
Vector VICTR76
Project tigm

Sequence tag IST12606C4BBF1
Sequence
TATCCTTGGTTGTGTGTACTGCAGTTTGACTGGTTGGTGANAGAGGTGGTTCATGTCCNCACCATTTTGCACTGGTTGGA
TGTGACATGAATCAAAAGAGCAAAAAATAAGTTTTGTGGTGCGTGTGTGTGTGTGTATTTAAAATGAATTTTACTANATC
TG
Sequence Type genomic DNA
Unitrap ID UNI30854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109045929..109046089 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030649 (3200002M19Rik) NM_027532 RIKEN cDNA 3200002M19 gene Gene [Source:MGI Symbol;Acc:MGI:1922680]


Sequence tag IST12606C4HMF1
Sequence
TATCCTTGGTTGTGTGTACTGCAGTTTGACTGGTTGGTGANAGAGGTGGTTCATGTCCACACCATTTTGCACTGGTTGGA
TGTNACATNANTCANAANAGCAAAAAATAANTTTTGTGGTGCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000030649


For any suggestions or comments, please send an email to unitrap@crg.es