Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P114E07
Clone ID P114E07
Vector FlipROSAbetageo
Project ggtc

Sequence tag P114E07
Sequence
GCTTCCCACAGCGACTCNNACAAAGCANNNNACNNCTTTATAGACAATATNAGANNCCCTCTCCTCTCAGCNNAGAACAA
AAACTTCTTATTATAATTANNCCCCAATCTTTCAAGGGAGAAGANNTNNANNCCCNCTCCAAAGTTTCTTTAAATGCACT
TAAGAAANNTGTTGGTTTAGAGGAAGAAAAAAATTATANNNTGAAAGAGCCTGCATACATAGTCGAAAGGCCTAGCACTG
CAAAGGGCAAGCCCAAGGAAGAAGACAAAGGCTCTGATAGAATAACAGTGAAGAAAGAAGTGCAGTCACCGGAGCAGGTA
AAGTCTGAAAAGCTCAAAGAGCTCTTTGATTACAGTCCCCCTCTACACAAGAGTCTGGACGCACGAGAAAAGTCCATCTT
CAGAGAGGAGAGCCCACTGAGGATCAAAATGATAGCCAGTGATTCTCACCGTCCTGAAGTCAAACTCAAAATGGCACCTG
TTCCTCTTGACGATTCCAACAGACCTGCCTCCTTGACTAAAGACAGGCTACTTGCTAGCACGCTTGTCCATTCTGTCAAG
AAAGAGCAAGAATTCCGATCCATCTTTGACCACATTAAGCTGCCTCAGGCCAACAAAAGCACTTCAGAATCATTTATACA
ACACATTGTATCCTTGGTTCATCATGTGAAAGAACAATACTTCAAATCACCTGCAGTGACCCTAAACGAGCGGTTCACTT
CATACCAGAAAGCTACTGAAGAACATAGTACCCGGCAAAAGAGCCCCGAGATACACAG
Sequence Type mRNA
Unitrap ID UNI10820

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20045247..20048013 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037608 (Bclaf1) NM_001025393 BCL2-associated transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1917580]

 
Come back to gene ENSMUSG00000037608


For any suggestions or comments, please send an email to unitrap@crg.es