Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14407A11
Clone ID IST14407A11
Vector VICTR74
Project tigm

Sequence tag IST14407A11BBF1
Sequence
GTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGC
TCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI26585

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41963790..41963894 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 51854789..51854893 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23162515..23162619 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18619054..18619158 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 61034782..61034886 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93920037..93920141 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67295592..67295696 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 58498917..58499021 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8247800..8247904 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3273252..3273356 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005534 (Insr) NM_010568 insulin receptor Gene [Source:MGI (curated);Acc:Insr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13585312..13585416 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147476006..147476110 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 107781414..107781518 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 74661470..74661574 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7259260..7259364 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 8824212..8824316 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 59283156..59283260 105
NO GENE  


Sequence tag IST14407A11HMR1
Sequence
NTTAATTACACCAAAAGAATTTANACTGACCAATTCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 9119187..9119222 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74917016..74917051 34
NO GENE  


Sequence tag IST14407A11HMF1
Sequence
GTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGC
TCACAACCATCCGTAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAATA
AATAAATCTTTAAAAAATGCATAATAAATGAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136008590..136008783 182
NO GENE  

 
Come back to gene ENSMUSG00000005534


For any suggestions or comments, please send an email to unitrap@crg.es