Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P128B08
Clone ID P128B08
Vector FlipROSAbetageo
Project ggtc

Sequence tag P128B08
Sequence
TTGGACCTTGGCTCCGCTCTTACCAGTGGCCCTTAGGCTCTTAGGCTTTTGGCCTTCCTTAAACTGAGAGCTTCACTCTT
GGTTTCCCTAGTTCTGAGGCCTTCAGACTGGGACTGAGCTCCACCGCCAGCATCTCCGACAGCTTTCAGACTGCCGTGGG
CCTTCTCTGTTGCCGCGACTCTGTCTGCTCNNNCCTGAGAAGTGATGGATATTCTTCACAGAGGAGAATTGGTTGCTGCA
ATACNNNGCAACCG
Sequence Type mRNA
Unitrap ID UNI2640

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22892256..22938801 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036782 (Klhl13) NM_026167 kelch-like 13 (Drosophila) Gene [Source:MGI (curated);Acc:Klhl13-001]


SPLK-Sequence tag 5SP128B08
Sequence
CACAACTTCATTTTATCAATGTTCACAGACGAGGTGGTGAGAAACCTATGAAACACATTTCTTTGCTCTACATATTAGCC
ATTTTATCTTTACTTAGAAAATTGACAAGAGCATTGCTTTTATTCTAGTTAGNNGTTTCTCTTGCTCAGTCCAGTCTACT
AGTAATCTCCGGAGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036782


For any suggestions or comments, please send an email to unitrap@crg.es