Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P128C04
Clone ID P128C04
Vector FlipROSAbetageo
Project ggtc

Sequence tag P128C04
Sequence
CTCTCTGTAGCTCCGGCTGCTGTGGAATTTACAGCATAGCCCAGAACTCGAGGCGTCTGCTTAACCCGGCTTCTCAAATG
TAGGCCTATAGGAAGTTTGGTGAGCGGCCTCCACCCAAACGACTCACTAG
Sequence Type mRNA
Unitrap ID UNI2686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53947054..54018660 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es