Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11991E12
Clone ID IST11991E12
Vector VICTR76
Project tigm

Sequence tag IST11991E12BBF1
Sequence
CCGGGCATGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGC
Sequence Type genomic DNA
Unitrap ID UNI20568 UNI30865 UNI30866 UNI30867

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 1025636..1025679 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4353846..4353889 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6123946..6123989 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3358167..3358210 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 33825029..33825072 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 13906578..13906621 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6995881..6995924 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4280818..4280861 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020647 (Ncoa1) NM_010881 nuclear receptor coactivator 1 Gene [Source:MGI Symbol;Acc:MGI:1276523]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3240986..3241029 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20860903..20860946 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 18553807..18553850 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021779 (Thrb) NM_009380 thyroid hormone receptor beta Gene [Source:MGI (curated);Acc:Thrb-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5748555..5748598 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6902776..6902819 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 21716691..21716734 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16893341..16893384 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 14569416..14569459 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21668225..21668268 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028252 (Ccnc) NM_016746 cyclin C Gene [Source:MGI (curated);Acc:Ccnc-008]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 97524889..97524932 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34434526..34434569 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044149 (Nkrf) NM_029891 NF-kappaB repressing factor Gene [Source:MGI (curated);Acc:Nkrf-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3383740..3383783 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3375132..3375175 44
NO GENE  

 
Come back to gene ENSMUSG00000044149


For any suggestions or comments, please send an email to unitrap@crg.es