Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12733H7
Clone ID IST12733H7
Vector VICTR76
Project tigm

Sequence tag IST12733H7HMF1
Sequence
AGAGTCTCTTTAGTGTTCCCACCTGATATGTTTTGGGGACAAAATGAATCTGTTGCTCTGTACTGATATCTGTGACCCAG
AGGTTTTGTATCATGAACGCATTAGGTTTGGGGAAGGAAAAAATAGCCTTGAAAACATTTGTGTGAACTTTACTTAAGAC
AGGAGGATGTCCGTTAGCTGTGCTGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI30875

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 60495525..60495713 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047766 (Lrrc49) NM_145616 leucine rich repeat containing 49 Gene [Source:MGI (curated);Acc:Lrrc49-002]

 
Come back to gene ENSMUSG00000047766


For any suggestions or comments, please send an email to unitrap@crg.es