Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14954D11
Clone ID IST14954D11
Vector VICTR76
Project tigm

Sequence tag IST14954D11HMF1
Sequence
CAGTATTATCCTCCGGTTGGACATTCCTACCCACTTCCTACCAGGTTTCAGAGCATCCCAGAGGTCTCCAAATTTCTTGT
TCTCTTTCACGTTTATGCAGCAACTAGTTGAGAGTTATGTTAGTTTCCAAACTACTAGCCTCTTATGGTATCATTGCTCA
CAGGATTCTGATGCTGTTGTTGATTGTTTTGTCTCGGGTTTTCAAGCAGGGTTTCTCTGTANCTCTGGCTGTTCTGGAAC
TTTCTGTGTTA
Sequence Type genomic DNA
Unitrap ID UNI26454

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8963746..8963995 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071653 (1810009A15Rik) NM_025463 RIKEN cDNA 1810009A15 gene Gene [Source:MGI Symbol;Acc:MGI:1913526]


Sequence tag IST14954D11HMR1
Sequence
ACTGTACGTACGCCCGCTTCTTGAGGTGGTGCTTCGTAGTCAGCCCTTCGTCTATCACAGCCCCGACCACCTGGCGTTTC
CGTCGCCGATCCCTGCTTAATACCCTGCGGCGCTTGAACAACTTCTTCTTCAGCTCCTGCGGAAGAAAAAGATGCGCATG
TAAGGTTCTGCACACCCACCCGGGATCCTCCGCACCTAACAACCCCAGCCCCTAACTAATCCTGTTTCCAAAGAGGAAAA
TGCCGGGAAGCAAAGGGAAACAAAGACGCANTTCCCACTCCCACAGTTCANTCACCGTCCGGGGACGATTGATCTTTCCT
CCCGGAGGTGCCATGGCTACACTCCGCGGCTCATTCCAAAAGCCGCACTTCCGCTCCGCTCACAGGTTCCGCCACACGCA
AAAGACCCCGCCCTCTGATGCCTCCGAANNNNTCNNANCTTGGANGCGGGCACNNNGGGTATATNAGGTTGTTCCGCGCG
TNGCGGNGCCTTTCCNAGGNTGGTTTTCACGTGAGTCNNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8963233..8963749 481
 
EST/CDNA Est Name
  AA939440.1 - BB257344.2 - BY717263.1 - BB640694.1 - BQ128943.1 - DV041456.1 - AA290313.1 - CO041481.1 - AW546850.2 - CR519859.1 - CK336325.1 - BG072777.2 - CK336614.1 - CK618547.1 - BF466508.1

 
Come back to gene AA939440.1 - BB257344.2 - BY717263.1 - BB640694.1 - BQ128943.1 - DV041456.1 - AA290313.1 - CO041481.1 - AW546850.2 - CR519859.1 - CK336325.1 - BG072777.2 - CK336614.1 - CK618547.1 - BF466508.1


For any suggestions or comments, please send an email to unitrap@crg.es