Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14958E10
Clone ID IST14958E10
Vector VICTR76
Project tigm

Sequence tag IST14958E10BBF1
Sequence
ACATTCTCGGTGGTCTCTTCTCTGAGTGTTACCCCAGAGACGAGCCTGTTTGTGCTTTCTGGTCTGCTGAGAGCAGTTTC
TTGTCTGGTGGAGCAATCCTTTATCTTGTGGCTCTAGGTATGCTAGGGTGCTATCTGAAATCCATTTGTTCCATCACCTC
CTTTCAGCTTCATCTTCTGTCTCTATGGCTCTGTTTCTCANGACAGATTATCTGACTCCCAAGCCCATTTTTTTTTTTTT
TTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI27510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88149990..88150245 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005621 (Zfp592) NM_178707 zinc finger protein 592 Gene [Source:MGI (curated);Acc:Zfp592-001]


Sequence tag IST14958E10HMR1
Sequence
TGTGACCCCTACTTACCAGCACCCATCCACCTAAGACCGCCTCTGCTTCCTACTTCCTCTTCACACTTCAACTGCTTCCA
AAACTTGCTTGACACCACAGAGATGTTGAAGGTTGGGGCNNNNNNACCCNTTGNNNNAGGCTATNCNNCNGACATCACCC
TGGCATCATCAAGTCTCAGTGATACCATTTGTTCCCTCCCAAGGCTGCCTTCTGACCTGTTGTCTCACTCCTGACCACCT
CTGGTCTTTCCCTATGTCATCACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000005621


For any suggestions or comments, please send an email to unitrap@crg.es