Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14956E9
Clone ID IST14956E9
Vector VICTR76
Project tigm

Sequence tag IST14956E9HMF1
Sequence
ATGTGACGGCAGAACACTCTAATCAGAGGCCAAGCAAGTAGGAAGGCTGTAGGGCCCGTTCCTGCCAAGGCCTGGGGTGT
TTGAGGAACAGTGTATCTACCATAGTGTGAGCAAAGGTAGTGAGGGCCAAAGTATGGAGAGAAAATGTCAAAACAACAAC
TCCAGCAACACAAACAAACAAACAAAACAAAAGGCAGGGGAGCCCACACATAGGGTCTTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI30876

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 86556914..86557136 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038007 (Asah3l) NM_139306 N-acylsphingosine amidohydrolase 3-like Gene [Source:MGI (curated);Acc:Asah3l-001]


Sequence tag IST14956E9BBF1
Sequence
ATGTGACGGCAGAACACTCTAATCAGAGGCCAAGCAAGTAGGAAGGCTGTAGGGCCCGTTCCTGCCAAGGCCTGGGGTGT
TTGAGGAACAGTGTATCTACCATAGTGTGAGCAAAGGTAGTGAGGGCCAAAGTATGGAGAGAAAATGTCAAAACAACAAC
TCCAGCT
Sequence Type genomic DNA
Unitrap ID UNI30876

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 86556914..86557079 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038007 (Asah3l) NM_139306 N-acylsphingosine amidohydrolase 3-like Gene [Source:MGI (curated);Acc:Asah3l-001]

 
Come back to gene ENSMUSG00000038007


For any suggestions or comments, please send an email to unitrap@crg.es