Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D028A03
Clone ID D028A03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D028A03
Sequence
TNNGCCCGGGAACAGNNNTCCTCCCATCTAAAAAGGGAAGGGGTCCAAGGAGCCGANNTCCTAGCCGCCTAGATTTCCAC
TGTGGCTCTGGGTACGAGTGGCAGTTTCTTCTTGGGATTTCAGAAAGGANNNCAAGGAGGAAATAGAGCGCACCGCATCG
CTGTGGGCATTAGAGAAATGGACTAAGAGCTGGGACACGTGGCAAAAGAAGATAGTCTTCTTCTCTCAATAGAGTGAGTG
TGCAGTGCAGCCAGCAG
Sequence Type mRNA
Unitrap ID UNI369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44389830..44392361 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]


SPLK-Sequence tag 5SD028A03
Sequence
AATATATGTCCCAAGACATATATGATTTATTTATTATCGTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es