Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10919E9
Clone ID IST10919E9
Vector VICTR76
Project tigm

Sequence tag IST10919E9HMR1
Sequence
ATATTAACCGAGAAATAATGGTAGAATGTTATTTTTTAAGCTCTCTACAAAATAGGATTCTTANTGCCAGGAATTTTTTT
ATTCCCCCTTCTGGCAGTTTTAAATTAGTATCACATTTTCTCAGCTTGGTAGGTGACATTTGGGAAGATGCAGATTTTGC
CTCAGCTGCTANAAGGCAACTCCTAAAAATATAAGTAACTTCTAGGTGANAGCTATCCCTCATATATACATACATATGCA
CGCCTGCCCACCCACCTGCCCATATGTCTGTGTACGTGTTTTGGTCCCTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI16954

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 191743729..191744021 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026603 (Smyd2) NM_026796 SET and MYND domain containing 2 Gene [Source:MGI (curated);Acc:Smyd2-001]


Sequence tag IST10919E9HMF1
Sequence
CACANAGCTGTGCATCCCCCCCTTTAATACACAAGAACAGGTNNNGNNTNNNNCACACACAANTAGGANANGGAGTAACN
CNNNCTTANAACGATCTAGCAAANCTNACCAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026603


For any suggestions or comments, please send an email to unitrap@crg.es