Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11058H8
Clone ID IST11058H8
Vector VICTR76
Project tigm

Sequence tag IST11058H8BBF1
Sequence
TTCCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTACGGACCTCCACCAGAGTTTCCTCTGGCTTCGCCCTGCCCA
GGCATAGTTCACCATCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACCTCCCCGGCGCGGCGGGCGAGACGGGCCGGT
GGTGCGCCCTCGGCGGACTGGAGAGGCCTCGGGATCT

Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391497..57391690 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]


Sequence tag IST11058H8HMF2
Sequence
GTAGAGGGGCAGCATCAATGTCCTATCAAAGAAAGAGTGCCCCACACGTATTCCCAGCACCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI13163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 78001782..78001846 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033373 (Fntb) NM_145927 farnesyltransferase, CAAX box, beta Gene [Source:MGI Symbol;Acc:MGI:1861305]

 
Come back to gene ENSMUSG00000033373


For any suggestions or comments, please send an email to unitrap@crg.es