Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10081B11
Clone ID IST10081B11
Vector VICTR75
Project tigm

Sequence tag IST10081B11BBR1
Sequence
TCGAACTACTATTTAGTGACACTTGAGAAAAGACTTTGAAAATCATATTTAACTTGGAAAGATGCTTCTGTATAAGGCAC
ATATTGCAGCTAGGTGGTGTGGTATGGTGCTGGCGCACGTCTTAGTACAGCACTTGGGAGGCAGAGGCAGGCGGATCTCT
GAGTGTGAGGCCATCCTGGTCTACAAAGTGAGTTCCC
Sequence Type genomic DNA
Unitrap ID UNI13159

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22413737..22413930 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST10081B11BBF1
Sequence
CTGAGTAAGGACCACGCAGGCTTAAGGGAATTACAAAACACTTGAGAGCGAAAGACAAAACCAACTTGGTGGCCCTCTGG
GCCAAGGCTGACCACCTAGGAAGTCTGTGGGGAACTTTGTGTCCACAGTATCTGCTCCCAGCCATTCCCAGCAGCCTATC
AGGAAGGGCAGGCTTCCATAAGAAGTCGTGGTACCCAGTGATGGTTTGTTCCCCTTGAAACTGTTTCCCAATGTAACCAC
ACTGAAGGGAGGTGTCTGGGTCATGAAGAGACGAAGCAGGGTCTCCACTTTTGTTTTTTAATTTCATGTTCACTGGTGTT
CTGACCGATTGTCTGTATGAGGGTGTCAGACCCCCATGAAACTGGAATTGCAGACATCTTAAGCTGCCACCTGGGTGCTG
AGAATTGAACTTGGGACCTCTAGAGGAGCAGCCAGTGCTCTTAACCGCTAAGCTATCTCTCCAGCCCGTTCTTCACTTTC
CATGAGTGTGCTTCACTGTCTCGTCTCTTCCCATGCACTCCCCGTTCCCTCTGCTTTGCATAAAGACTTCAGCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22413930..22414483 547
 
EST/CDNA Est Name
  CF736169.1 - CK634435.1 - CN461628.1 - CK636336.1 - CD542230.1 - CD542094.1 - BY322994.1 - CD545468.1 - CN687119.1 - CN686830.1 - BI664598.1 - BB658924.1 - BY739882.1 - BY729353.1 - BG919203.1 - CK620808.1 - CN684524.1 - CN683331.1 - BB620884.1 - CN678818

 
Come back to gene CF736169.1 - CK634435.1 - CN461628.1 - CK636336.1 - CD542230.1 - CD542094.1 - BY322994.1 - CD545468.1 - CN687119.1 - CN686830.1 - BI664598.1 - BB658924.1 - BY739882.1 - BY729353.1 - BG919203.1 - CK620808.1 - CN684524.1 - CN683331.1 - BB620884.1 - CN678818


For any suggestions or comments, please send an email to unitrap@crg.es