Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14724H6
Clone ID IST14724H6
Vector VICTR76
Project tigm

Sequence tag IST14724H6HMR1
Sequence
CATTATGATTCNTAACAGTAACAATTACAATTATGAANTANCAGTGANNGTNATTTTATGGTTGGGTGCCTACAACATGA
GGAACTGTATTAAAGTTTGCAGCATTAGGAAGGGTAAGAACCCCTTGTATAGAGACTTATGTTGTAGTTTAATGTGTTTT
GGTCAATGATATCATGCTTTCGGTGGGGCAGCACAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI4069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16111014..16111212 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]


Sequence tag IST14724H6BBF1
Sequence
AATGTAAATATCTGATATGCAGGATATTTGATTTGGGACCCTTAAAGGGGTCACAACCCACAGGTTGAGAACNNCTGCTC
TACACTTCTGTGTAANATTGAAAGAACACCAAACTAACTTTTGGAACATAAAATTAAGCTAGAAATAAAAGAAGGNAGAC
TGAAAACTTCATAAACATTAAATAAATTTTTAAACAAGAAACAAAGAAAAGGAGTCTTCCACTAGCAGCCTTTGGATGAA
GACACAGAACTCTCATCCCCTTCTGCACCATGCCTGCCTGGATGCTACCATGTTCCCACCTTGATGGTAATAGACTGAAC
CTCTGAATCTGTAAGCCAGCTCCNATTAANTGTTGTTTTTTATANGNAAAAAAANANNAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16111209..16111582 358
 
EST/CDNA Est Name
  CF907339.1 - CA571510.1 - CK342756.1 - CA572988.1 - CA571725.1 - CA572140.1 - CD547829.1

 
Come back to gene CF907339.1 - CA571510.1 - CK342756.1 - CA572988.1 - CA571725.1 - CA572140.1 - CD547829.1


For any suggestions or comments, please send an email to unitrap@crg.es