Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15013B11
Clone ID IST15013B11
Vector VICTR78
Project tigm

Sequence tag IST15013B11HMR1
Sequence
GAAGAATCCCACGAAAAANNNNNGTTGTCAGGCGGTCGCATCTCTGCCTGCCACCTGGTGTANTAACTTTGGGAACACTT
TTTCTCGAGCCTTGGTCTTCTATGTCTGAGAATGCAAGATGATGAAATCTCTTCCTTCCTCCGGGGGTGTGATACATGAG
CGCCCGGGAGTGGAGCGTGGTTTTGCTGTTTTCACTACGTTTGGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TCN
Sequence Type genomic DNA
Unitrap ID UNI20174

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35138825..35139066 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]


Sequence tag IST15013B11HMF1
Sequence
CTANATCTCTGAGCCCACAGCTCTGGCAAGACGTGGGCACCANCGTGGATGACTTCNNCTTATATTTTCTAANGGTNACT
CTGAATCCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es