Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14335F6
Clone ID IST14335F6
Vector VICTR74
Project tigm

Sequence tag IST14335F6HMR1
Sequence
ATTAAAAGACAGTAAAAACGAATGTTTGGTAAAGTACTAAAGTAAATGTCACCTATTTCAGCTACCTTGGAGGCTGAGGC
ANGAGGATGATTTGTGGANACAATGTAGGGATCCTATATCTTTAAAGAAAGACTGTAAATATAAGGTGCTAAATATGTAC
AATGGCACGTTCATGGAAGATATATGTTCTGAAAGTATGGTCAAAAATANAAATCGTAGGCCNNANATGGCTTANGGC
Sequence Type genomic DNA
Unitrap ID UNI22706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15107934..15108170 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031938 (4931406C07Rik) NM_133732 RIKEN cDNA 4931406C07 gene Gene [Source:MGI Symbol;Acc:MGI:1918234]


Sequence tag IST14335F6HMF1
Sequence
TAATTATTTAACACATATACTCGTGTGTTTCCAATGAAATATAAGTAATTATTGAAAATAGGTCCCAGCTGCTATAATCA
TACTTGAATTACTCTAAACATATTTTTCAATTGATTGTTTTTAATGGTTTAGAAGTAAAACATGCTAATTTTCTTTGAAA
TAGTTTAAGACTGATATATCATATACAAATCTAGCTTCCACACTCTTTACCCAGATGCCCCATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15108167..15108392 226
 
EST/CDNA Est Name
  BY788023.1 - CA491872.1 - BY118027.1 - BG404026.1 - AA103680.1


Sequence tag IST14335F6BBF1
Sequence
TAATTATTTAACACATATACTCGTGTGTTTCCAATGAAATATAAGTAATTATTGAAAATAGGTCCCAGCTGCTATAATCA
TACTTGAATTACTCTAAACATATTTTTCAATTGATTGTTTTTAATGGTTTAGAAGTAAAACATGCTAATTTTCTTTGAAA
TAGTTTAAGACTGATATATCATATACAAATCTAGCTTCCNCACTCTTTACCCAGATGCCCCATGTTAACAGTCTATCACA
CTTTGTACCAGGCGTCCAGAGATATTGCCTANTATACAGACATGCCCAATCTGCTCAATGAGCAGTGTGTTAATCCNATG
CTGATTGCTTGANTTTACTTTATTTTTTGTTGAGATAANGTTCACTATATGGCCCANGCNANTCTGGTACTGNGCTCTTC
CTGNTTGGANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15108167..15108575 389
 
EST/CDNA Est Name
  CA479322.1 - BF181800.1 - BB621923.1 - CK388709.1 - AW611075.1 - BQ557138.1 - BY003933.1 - CF906635.1 - AA396538.1 - CK387287.1 - BB743853.1 - BB474748.2 - AI121267.1 - BB658763.1 - AW990267.1 - BY137498.1 - CJ181736.1 - BY779195.1 - BU504184.1 - BY304761

 
Come back to gene CA479322.1 - BF181800.1 - BB621923.1 - CK388709.1 - AW611075.1 - BQ557138.1 - BY003933.1 - CF906635.1 - AA396538.1 - CK387287.1 - BB743853.1 - BB474748.2 - AI121267.1 - BB658763.1 - AW990267.1 - BY137498.1 - CJ181736.1 - BY779195.1 - BU504184.1 - BY304761


For any suggestions or comments, please send an email to unitrap@crg.es