Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11565G10
Clone ID IST11565G10
Vector VICTR76
Project tigm

Sequence tag IST11565G10HMR1
Sequence
TTGAATCTGGACAATTTANTTTATTTTACCCTGCTAACCAGTATCTTAGTGTATCTTCATTTGTTTTAACTCTCTCTGCT
TCATTGTGAGTANAGATAGCTGGATATGCTCTCTGTTGGGTGGGGCGGGGCANGGCGGGGCGGNNGCN
Sequence Type genomic DNA
Unitrap ID UNI30916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18144115..18144257 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]


Sequence tag IST11565G10BBF1
Sequence
AAGCTGGCCTTTAGCCTCAACCCTTGGGAGGCGGCGGCAGGAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18144069..18144116 48
NO GENE  


Sequence tag IST11565G10HMF1
Sequence
CAAGCTGGCCTTTANCCTCAACCCTTGGGAGGCGGCGGCNNGAANATCTTTGTGAGTTCAAGGCCAGTCTAGTCTACAAA
GCAAGTCCAGGATAGCCAGGGCTTGTTACACAGAGAAACTCTGTTTAAAAACAAACACACAAAAAAAGTATAGATTCCTG
ACAATTTTTGCCTCAAGAACTAAGTATATTGTTCTAAAACTTAAGTTCCTTATGACTTGAAAATTCAANATANATTTTTA
AGAAAAAGGTTATATATTTGGAAAACTCAAAGCTCTATACNGATCTACNGAATTCCAGCTGGGCGCGGTTGCTCGCTCCT
ATAATCTNAATANTNAGGANAANACAGAAATGGGAGGGCTGNNNAAAAGAGAAACCNNGGTCTCAAAAACNAATAACTAA
NAAACAAAACGTACAGACTTTCTATTAAAGGGTANCTTCTTTCTGAAAGANCCACATTGACCNACTTCTNACCTTCTTNA
ACCTNNNTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039835


For any suggestions or comments, please send an email to unitrap@crg.es