Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D037D05
Clone ID D037D05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D037D05
Sequence
GAGCCAGCCAACACTGATGATAACTATGGCAATAGCAGTGGCAATACATGGAACAACACTGGCCACTTTGAACCAGATGA
TGGAACAAGACTTGATTTCATTGGGGTTGAGGGGTCAAATTATCCCCGAAAATTTGAGACTGCTCCTGGTATGATACATC
CAGGTGCATGGAGGACTGCAACAGAAGAGTGGGGAACTGAAGACTGGAATGAAGATCTTTCTGAGACCAAGATCTTTACC
GCCTCTAATGTGTCTTCAGTGCCTCTGCCTGCGGAGAATGTGACAATCACTGCTGGTCAGAG
Sequence Type mRNA
Unitrap ID UNI10833

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89830515..89838074 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]


SPLK-Sequence tag 5SD037D05
Sequence
GATCTTGAGTTTATAGTAAATTAAAAGCCTTCAGTTCTTTCTGGTGCTCCATTGATGATCTATAATTTACCTGAATACTT
GAGACAAGTAGATTTTCTTAAATGTGTGTCTTTCACATTTCTGTTAGTGTGTTCTGCTTTCTCTGCACGCTGCTTGCTGC
ATTTCCCTTTATCTTCTCATGGTTTGACATCGGTTAGCCTGGTACTCAGATACCTGCCTGCCTCTTCTTCTTTGCTAGGA
TTCCTGCACCTCCACT
Sequence Type genomic DNA
Unitrap ID UNI10790

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 136494835..136495090 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030213 (Atf7ip) NM_019426 activating transcription factor 7 interacting protein Gene [Source:MGI Symbol;Acc:MGI:1858965]

 
Come back to gene ENSMUSG00000030213


For any suggestions or comments, please send an email to unitrap@crg.es