Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D037F05
Clone ID D037F05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D037F05
Sequence
ACTCTTCCTCAGGCGGCCGCCATGGCGGGACAAGAGGATCCGGTGCAGCGGGAGATTCACCAGGACTGGGCGAACCGGGA
GTACATTGAGATCATCACCAGCAGCATCAAGAAAATCTCAGACTTTCTCAACTCTTTCG
Sequence Type mRNA
Unitrap ID UNI3043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 113554752..113554890 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033940 (6720456B07Rik) NM_133937 RIKEN cDNA 6720456B07 gene Gene [Source:MGI Symbol;Acc:MGI:1915406]

 
Come back to gene ENSMUSG00000033940


For any suggestions or comments, please send an email to unitrap@crg.es