Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13645D6
Clone ID IST13645D6
Vector VICTR74
Project tigm

Sequence tag IST13645D6HMF1
Sequence
CACTGAGGATACACAAATATGACGTGTACAGGATAATGCCTCATACAAATCANATGTCCATTTGTTACTGTGTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32897672..32897749 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66347610..66347687 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727384..97727461 74
NO GENE  


Sequence tag IST13645D6BBF1
Sequence
CACTGAGGATACACAAATATGACGTGTACAGGATAATGCCTCATACAAATCAGATGTCCATTTGTTACTGTGTTTGTTAA
CAACCCTTTATCTCTTANTGTTATAAACTCCACTTAAAACTGATTAAAGTCTCATTCTTGTAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727313..97727461 143
 
EST/CDNA Est Name
  AA450527.1 - DV073594.1 - AV071666.1

 
Come back to gene AA450527.1 - DV073594.1 - AV071666.1


For any suggestions or comments, please send an email to unitrap@crg.es