Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14094E8
Clone ID IST14094E8
Vector VICTR74
Project tigm

Sequence tag IST14094E8HMF2
Sequence
TTTTNNGGNNNAGNNGGGANNNNNTNNNNNGNNANNGNNNNNTCCNGCNNCNGTNTNNNNNNACACCACTAGGATAACAG
TGGAAAGAGTCATTAGGAAAGAATAAGCNCGTGACCCANGGCCTCACACAAACTGCATTGTTAGTTCAGCCTGAACCNAG
AGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84848420..84848523 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14094E8BBF1
Sequence
ATTTTCTTGTCCTGTCCAAAATTCATTCCACTCACTACTGCCCTTTCCAGCTCCTGTCTACCTACACACCACTAGGATAA
CAGTGGAAAGAGTCATTAGGAAAGAATAAGCACGTGACCCAAGGCCTCACACAAACTGCATTGTTAGTTCAGCCTGAACC
AAGAGAGTCAACCTTTCAACCTCCGTTGCTGTTTGTGTATGGTGACAGGATTAAACACCACCTTCAACCCCATGCCCCAT
CCCCCACCCCTCGCCCTTGCTAGGCCAGAACTTTGCTACTTTCCCAGGCCCCTCAGTTTCACTGTGGTACACCCCCAAGG
CTTTTAGGCTCCCCAGTGCTTAAGGAAGATGCTTCTGCAATCANANATAAAGANGCCTGTGACAGAGGACAGGANTCNAA
NGGCTGATTTTCANATGTTATCNNCTGTACCTCTGGGTCCTGNNNTGCCTGGGGCNANCCACANCACTGCNCTCNTANAT
TANNNCCTTCNAGANTGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es