Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10889B5
Clone ID IST10889B5
Vector VICTR76
Project tigm

Sequence tag IST10889B5BBF1
Sequence
CTCTGAACTCCAAAATCTCTTCACCTAGCTGGCTAAGTTCCCACTGGCGAGTCTCTACCATGCCAGCCCTGTGCTTCAAA
TCCTCCACGGCCTTTGTGGTGCACATCAGGCAAACTCACACTTTGCTGCCNTACCTTTCTCTCTGGAACCCANAANAGCA
NCCGTGTGAGAGAAAACACAACACAAACTCAGTTCAGAGACAATGGTGACTCAATCTCTGGGCGCAACAACTAAAACTTA
ATCCTGTAAACCTTACTAAAATCTGATTCCTCCAGTGGTGAATCCTTGCAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI20076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96040042..96040337 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041440 (Gk5) NP_796326 glycerol kinase 5 (putative) Gene [Source:MGI (curated);Acc:Gk5-001]


Sequence tag IST10889B5HMR1
Sequence
NANTNNNGTCTCCATGAGATAAAAACAGGTCGGCCATTACTTGCTAGTGTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96039992..96040036 45
NO GENE  

 
Come back to gene ENSMUSG00000041440


For any suggestions or comments, please send an email to unitrap@crg.es