Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P097E07
Clone ID P097E07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P097E07
Sequence
ACANNAACAACAAACAACGAGAAACGTAANNAACACNNNNACNNAATACCACCCACNNNNACAAACAAAAGGAAANNACN
NAGAACCNNNNTACACNNGCAAAAAAAAGAGAATAAATAACAAATAAAGATCNNNNAANNATAATCAANATAAACAAANN
AAANNCGGNANNAGAACAAATCAGGANANNAATAACAGCTGAAAACCTNNNTAAAGAGGGGNNCANNAGANAGACTACCA
GGAANNNNTCATGCTNNGAAGCTGTCTTGGCTATCGGCCCCAGTAGGTGCAAGGCAAACCACTGGGGACCANCTCTAGTG
CAGAATTNNNCGTCATCAGTGCAGTCTGTCTGTGAGTCCTGGAATNNNATCANNNCCAATGAGTTNNNNAACATTGGATC
CTGGCGCAATGCATTTGCCAACGACNNNATCCCGTGCGAGAGTTACATCAGTNNNGTGCAGGCTGCTCACCTGGGGACTC
TGTGTGGCCAGAGTCNNNCCCTGGCGGCTTCCCTGAAACATACCCTCCTCTCCCTGGTCAGGTTGACTGGGGATCTGATT
GTGTGGTCAGATGAGATGAACCCAGCACAGGTGATCCGGACTCTGTTACCGCTTCTCTTGGAGTCAAGCACAGAGAGCGC
TGCTGAGATCAGCAGTAACTCTCTGGAGCGCATCTTGGGATCTGCGGAGTCTGATGAGTTCCTGGCTCGTGTGTATGAGA
AGCTGATCACGGGATGTTACAACATTCTGGCCAACCATGCAGATCCCAACAG
Sequence Type mRNA
Unitrap ID UNI10835

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138968545..138971124 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]


SPLK-Sequence tag 5SP097E07
Sequence
ATGGGTGGTCGGGGGAAAGGAGGCCTTTGATTGCCCTCATTGGNNNNCGCTGTGGGGATGCACAGGACCCTTCTAGGAAC
TGGTGCTTTCTATCTCCTCACTGTTGATGACTTGCCTGCCTGTCTGCCTGCCTTTTTCTTTCCTCATTTGCCCTGTCCTG
CTCTGTGGCCAGGCTGCTTGAACTTGGTTTTCTTCTTGCCTTAGCCTCTGCGCTACCAGATTGTGTGTCACCATTCCTTT
AAACAACAAACACTTTTGCATGGGTGTGCACTGGTGTCCTGTGGGGCCCGAGGCCAACACTGGGAGTCTTACTGTTCATT
CTCCACCGTGTGCCCCTAGCCAGTGAGCCAGGGCCTGTCAGGTGAGCTGGGCTCAGGCTTTCACTTGGGCAGTCAGCCAG
GCTGCTCCTATGTCCAGCCTTGTCTCCAGCATCCTGGGCTGCAACACCCACCAGCATCTGTGTGGATATTGGGAGTCTGA
ACTGTGGTCGTCACTCTTGTGTGGCAAATAGTTGACACATTGAGCATTTCCCAAGCCCCTTCTTCGCTTTTCAAACGTAG
GCACTTAGGTGACTTCTCTCTGCAGGAGTGAGTCTCCCAGACTCTCTCTTCTGAAAACAGTCCGATGCCAACCACCACTT
TCGCCCAGCTTCAGATGCCTTTCCTCTCTTTATTCATTTTTATTTCTACTTTCCA
Sequence Type genomic DNA
Unitrap ID UNI10835

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138971404..138972098 672
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]


SPLK-Sequence tag 3SP097E07
Sequence
TCACACCTNNNTTACTGTTCTTCTTTATTTTTCCCAGGAAATAAGGTAGTAAAACAAAATTGAGGTCTTGCTCTTCTTGG
GTTAAACATTTATTGAACTTGAACTATATGTCAGTGTTTATGTTAAATGAAGACAAAACAAAACTTGAGGTGTTTATCTC
AAGTCTAGTCATCAACATGTTCTTCAGAGGCAGTCGGGAGGGCTCTGAACTGTGGTCTTGGTCCTCAGTGGGCTGGATGA
GTCCATTCACTGAACTGTGGTCTTGGTCCTCAGTGGGCTGGATGAGTCCATCCTGGAGGAGTGTTTACAGTATCTGGAGA
AGCAGCTGGAGAGCAGCCAGGCCCGGAAGCCCATGGAGGAGTTCTTCTCTGATGGGTGAGCACTAAAAGTGGGGCTGGAT
GTGCCAGTTCAGCTGCCTCGCGACCAAGGAGGCCTNNNNNCAGTGTGAGTCTCCTGGGGAGCCATAGCTTGTGTGGGACC
CACAAGGGACCATTTTCCCCAGGGTGAGACTGAAGCACAAGCAGGACTTCCTAAGTGAGNGNTGATGTGGGTTTCTTGTT
TCCCCCTCACCTTGCAGTGGGGAGCNNGTGCAGATCATG
Sequence Type genomic DNA
Unitrap ID UNI10835

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138972195..138972792 567
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]

 
Come back to gene ENSMUSG00000066036


For any suggestions or comments, please send an email to unitrap@crg.es