Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D040G10
Clone ID D040G10
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D040G10
Sequence
TAGAGTGGGGCAGGGCTGAGGTAGGAGAAACTGGCAGGAGATGCCAGAGTGGCTCTTTTCATGCAGCAACAGAAGCAAGG
GAGTCAGGGCAGAGCACAGAAAGCACAAGGGGGTTAGGGCGAAAGCTGCTTTTCTCCAGGCTGTGGCAGAGCTCAAACGA
CCAGGCAGAGACAGTGGCAGCCTTTGCTTGTAGAACACAAGAACCCTGCCCTCCAGACGAGAAAACATGTGAAGGAGCAG
CAACAGCTGGCGGCGGCTGTAGCGGCGGAGGCTTCGGCGTCGGCGACAGCGACAGCGACGGGCTCTGGTGACGACTTCTC
TGAGGG
Sequence Type mRNA
Unitrap ID UNI6910

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155964813..155970767 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]

 
Come back to gene ENSMUSG00000044150


For any suggestions or comments, please send an email to unitrap@crg.es