Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11762F1
Clone ID IST11762F1
Vector VICTR76
Project tigm

Sequence tag IST11762F1HMF1
Sequence
ATCCTTGTCTCTGTGTAANAAAGCAAAGGATGCTGGGTACATTTCTTCCCGGGCGAGCTCCGGAACTGCCTAAGGCCGAA
GGTCTTTGCTGTTTACATCTGAGCACCGTTATAACAGTATAATACNNNGNTGCATTAAAATTCCTTTCATGCTTTTCGCA
TCTTGGGCAGGAGAGAATGAAAAACNNCAGCATGAAAATCTACCAGAANACAACATTTTCGTCCCGAATGAAGAGTCGCT
CACACCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI25764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93012737..93012986 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036168 (Ccdc38) NM_175488 coiled-coil domain containing 38 Gene [Source:MGI (curated);Acc:Ccdc38-001]


Sequence tag IST11762F1BBF1
Sequence
ATCCTTGTCTCTGTGTAAGAAAGCAAAGGATGCTGGGTACATTTCTTCCCGGGCGAGCTCCGGAACTGCCTAAGGCCGAA
GGTCTTTGCTGTTTACATCTGAGCACCGTTATAACAGTATAATACTTTGGTGCATTAAAATTCCTTTCATGCTTTTCGCA
TCTTGGGCAGGAGAGAATGAAAAACCNNNGCATGAAAATCTACCANAAGACAACATTTTCGTCCCGAATGAANAGTCGCT
CACACCTTGGCCAGCTAGCTTTTTTCGCTGACGCAGGCAGCTCCTCCTATGAACGTCTGGGGCTANATCCCACTCTTATT
CTCAGGCTGACAGANNGTAANTGTGAGGGTTCGAANANGTTTTACCCTCTACAGACTCNTGTGTTCNAATGGCTCANANG
TAGGTAGTGTTACTATTANGAGGTGTGGCCTTTATNNANGACATTTGTCACTGTGGGGCGAGCTTTGTCATCTTAAACGT
TNANNNTATGCCCAGTGTGAAACAAATCCNGCCTCNTCCTGGCTTNCTGCTAATCNANGTGGANAACTCTCTGCTCCTCC
AGTGTCATGTCTGCTACAGNCTGCCATGCTTCCTGCNNTGATGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036168


For any suggestions or comments, please send an email to unitrap@crg.es