Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P149C03
Clone ID P149C03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P149C03
Sequence
AAACCACACAACCCAACACTCCACAANNANNCAATCNNNNCANNCACACCCTAACCACCTCCCAANNAANNCACACACNN
ACAACCCAAAACCNNCAANNCCACCCNNCCACGCCNNACCACCCTACNNACACACCAAAACANNCAACCACCACACNNAA
CCTAACCCACCCTAACTACAACACATAACCAAACAAAAANNCACCACAGCCAAAGTACNNNNACCAACATCCAAACAACC
CACAACCCCTACCAAACCATTTAAAACAANNCNAACCCACNNAATCGCCCAATACAAAACCAAATCCCAATCTCNNCCCN
NNNAANNAACCGGGTAATGCCCTGCTTCAGAGCATGGGAAGATTGGCCAATTTATCCAGAACNNTTTCTGATCAAACTTC
AGAATATTTTCTTAGGACTTGTAAATATCATTGAAGAAAAGGAAACAGAGGATGTGCCGGATGATCTTGACGGTGCTCCC
ATCGAGGAGGAGCTTGACGGGGCGCCTCTGGAGGATGTGGATGGGATTCCCATCGATGCCACTCCCATCGATGACCTGGA
TGGGGTCCCTATAAAGAGTCTTGATGATGATCTGGATGGAGTGCCTTTGGATGCAACTGAAGACTCAAAGAAGAATGAAC
CCATATTTAAAGTTGCCCCATCAAAATGGGAGGCTGTAGATGAATCTGAATTGGAAAGCACAATCGGTAACTGTCTTGTA
ACTCGAATTTCTTCGACCAGCTTGCAGAGTCAGTAGTAGAGGANNACGCACAG
Sequence Type mRNA
Unitrap ID UNI10837

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 95375622..96065274 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032407 (2610101N10Rik) NM_026476 RIKEN cDNA 2610101N10 gene Gene [Source:MGI Symbol;Acc:MGI:1915208]


SPLK-Sequence tag 5SP149C03
Sequence
GATCCACAAAAAGTGATTTTAAAGTGGAGTAGGAAGACCATACTCTTTTCCTTGTGGATAGTGCATCACTAACAACTGCT
GTTGTTTTAAATGTAAACATGTCAGAAGAACGAGAGTGTATGCAGGGGAGCTTCTTAAGTATAAAGAAATTATAATTTTG
ATAGTTTTCTCTTGTAATTACTAGAGAAATATTTTTGCCTTTGACATTGTGGTGATAAGAAAATAATGACATTGATAAAT
TTTAGGAAGCTTCATACATTTTACAGTCATTGCTGTCAATACTGGGCTTTACAATAAAAAGAGTCTTTTGTTTTATGAAA
ACTAAGTAGTCTTATTCTCAGATGGATGAAGAACAAAGGCAAGCCTGTTGGATAGCCCAGCACAGAGTGTGCACTTGTGT
GCACGCAAACAGACTGGTGGGCTGCAGGGAGGTGTGCTCAGTCAGCAGTTTGTAGAAACTGACATATGTCTTCAGAGACA
TTGATGTGCCTAGAACAAGTTAGTAATGATAAGATACTTACAAAGCAGAAGTGTGGCT
Sequence Type genomic DNA
Unitrap ID UNI8330

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 95374032..95374569 538
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032407 (2610101N10Rik) NM_026476 RIKEN cDNA 2610101N10 gene Gene [Source:MGI Symbol;Acc:MGI:1915208]

 
Come back to gene ENSMUSG00000032407


For any suggestions or comments, please send an email to unitrap@crg.es