Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10491F4
Clone ID IST10491F4
Vector VICTR76
Project tigm

Sequence tag IST10491F4HMR1
Sequence
TNNNGTTTTAATCTAAGGAGCATTCTGGAGGTTTCCACCAGAGTTAAAATATCTAGGGTCAGAGTTATAGCTCTGGCAGA
GGGCTTGCCTGTCATGAATACAGCTCTGGGTTGATGGTTTGTTTTGTTTTTGTAACCTANACTANCTTTGAACTTGTCAT
CTCTGGAGTGCN
Sequence Type genomic DNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109974351..109974517 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]


Sequence tag IST10491F4BBF1
Sequence
AACAAAAACTAAGCCGGGCAGTGGTGGTGCATGCCTTTAATCCCAGCTCTTGGAAGGCAGAGGCAGGAGGATTTCTGAGT
TCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGAACAGCCAGGGCTATACAGAGAAACCCTGTCTCAAAAAAACAAAAA
AAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109974166..109974333 168
NO GENE  

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es