Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13050C7
Clone ID IST13050C7
Vector VICTR76
Project tigm

Sequence tag IST13050C7HMR1
Sequence
CATCCACATCCATTAAAGTCCGATCCCTGGAGAACAGAGGAGCGGTGGGGAGGGTACTCAGAAGACTTCAGTGTTGTGGA
CGTGGTCACTTTAGGGCAGCAGAATATTCTGGAACTACATAGCAATGGTTGTCCAGCCTTGGGTGTATCAAACACCATTG
ATTTGTTTACTTTTGTAATGACTGTTCCATACATTTTTGTCTCAATAAATACATGTAAGAACTAATGAAGTTTTTGTTCA
TTTGTTTTAATTTTTAAGTGAGCATTTATTACAGGGGCTGGAGAGAGAGATGTTCAGCGGTTCAGCGCATTTGTTGCTCT
TGCAGAGGACTCGGGTTCAAATTCCAGCACCCACATAGTGGCTTTCAGCCATCTGTAGCTTCNATTGGAAGGACCCAATA
CCCTCTTTTGGTTTCCACAGATATTGTCACACACAGTGGTACACAGACCTACGTGCANGCNAAACATCCGTAAANCANAT
ATTTTNNANGTTACCNTTATTTATTGTGTCNGTTNGGGANANTGAGTCATANNCNTAGGTCAATGGTGCGNANGTGGNAG
TNAN
Sequence Type genomic DNA
Unitrap ID UNI18902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125641766..125642324 519
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]


Sequence tag IST13050C7BBF1
Sequence
NATGCTTCTACCCCCAGCTCACACATGCCTTCCTTCCGGTGCTCCCTCTTTCGTTCCAGGTCACTCTGGGTCGAGTTCCT
AGAGGTAGAGGATGTGGTGTTTCACTCTGTTTTGTAGCTGAGTAATAATGGATTGTGTGGCCAGGTTAATGACATCGTAT
TTTTTTTTAANATTTATTTACGTTCAGTTTGTGTGTTTGCGTGCTCTGCCTACAAAAACATANATGGGTAACATCNCNGG
CNTACGGTGCTGACAGGTCNNAANAAGGTNTNNNATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13050C7HMF1
Sequence
NATGCTTCTACCCCCAGCTCACACATGCCTTCCTTCCGGTGCTCCCTCTTTCGTTCCNNGTNNNNCTGGGTCNAGTTCCT
AGAGGTANAGGATGTGGTGTTTCACTCTGTTTTGTANCTGAGTAATAATGGATTGTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029478


For any suggestions or comments, please send an email to unitrap@crg.es