Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10951E2
Clone ID IST10951E2
Vector VICTR76
Project tigm

Sequence tag IST10951E2HMR1
Sequence
GAATTCNGTTTGGTATAATTCTGCACTGGATCCATCTGGTCCTGGGCTCTTGTGGTTGGGAGTCTTTTAGTTACAACTTC
TTGGATCTTGGTTTGTTTAAATTGCTTATTTGATCTTGGTTTAACTTCTGTATGTCATAATATGAAGAAATTCATCCATT
TCTTTGTATTTTCCAGTTTGGTGGATTACAGCTTTTTNANACGTGTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI3444

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20257318..20257532 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063108 (Zfp26) NM_011753 zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]


Sequence tag IST10951E2BBF1
Sequence
AATTAATGCTAATATTCCTCATATTATTCCACAAAATANAAACTGAGGGCATTTTTTCTAATTCCTTTTATGAGGCCAGT
TACCCTGATACCAAAACAATGCACCANCCTCTCAAAAAAAAAAAAATTTTTTTAAAANNNTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20257537..20257674 130
NO GENE  

 
Come back to gene ENSMUSG00000063108


For any suggestions or comments, please send an email to unitrap@crg.es