Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10076D10
Clone ID IST10076D10
Vector VICTR75
Project tigm

Sequence tag IST10076D10BBR1
Sequence
TTCTCCATACGGCTAGTTGGTCTTTCTGAGGCTATGAGAGCATCTGTCTACCCCTGGTGGGCAATGTCTGCGAATTCTTT
CGAGCTCACGTGTGGGGAGAGTGGAATGGGGACCTCTCCTGAATTCTAGAATCTGGATTTAGGGTGGGAGTTTCCTCTCC
TCCCCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71025295..71025466 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


Sequence tag IST10076D10BBF2
Sequence
TTTTGACTTTATACACAGACTAGAAATCTGTAACAGGACGAGCATATAACCAGTTCTTACTACATCTTTTCTTCCATACC
CACCCCCTCCATATCTTAAAGAGTGTTAAAATATTTTGCTGAGCGGGAGTAGATTAACAAGGTTCCTTTGCCAATGCCGG
GAAGCTGGTATCACAGACCATCCCAGGGGAAAATGGCTCACATTAACCACTAAATGAATATTTGACAAGGGCTCATTCGG
AGGTATTATTACTATAAATGTGTCCCTACTGGACTTTTCAAGGTCAAAGAGCAATGCTTCAATTAATTATTTAGACTGCT
AGTAGATTTGGATGTAATAGCTGTACTTATTTCTGGAAAGCGACACATTCTTGCAGTGGGGAAACCTCCCGAGACTCTCC
ATCAGCAGCATCTCAAATGGAAAGGTGTGTGAAGCCCTGGCATGCCCAAACTGACTTTTTTTTTTTTTTTTTTTCACA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 34553690..34554165 474
 
EST/CDNA Est Name
  CF737208.1 - BB644101.1 - BB622068.1 - CN665560.1 - BE647324.1

 
Come back to gene CF737208.1 - BB644101.1 - BB622068.1 - CN665560.1 - BE647324.1


For any suggestions or comments, please send an email to unitrap@crg.es