Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14238F9
Clone ID IST14238F9
Vector VICTR74
Project tigm

Sequence tag IST14238F9HMF1
Sequence
GGTGGCNCACAACCATCTGTAACAAGATCTGACACCCTCTTCTGGANTGTCTGAAGACAGCTACN
Sequence Type genomic DNA
Unitrap ID UNI4023 UNI4479 UNI4521 UNI7177 UNI7761 UNI21138 UNI30929

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45989450..45989513 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 65127115..65127178 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024589 (Nedd4l) NM_031881 neural precursor cell expressed, developmentally down-regulated gene 4-like Gene [Source:MGI Symbol;Acc:MGI:1933754]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 7782917..7782980 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31572246..31572309 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 77684416..77684479 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 30527085..30527148 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 81934002..81934065 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021133 (4933426M11Rik) NM_178682 RIKEN cDNA 4933426M11 gene Gene [Source:MGI Symbol;Acc:MGI:2444661]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19834553..19834616 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045671 (Spred2) NM_033523 sprouty-related, EVH1 domain containing 2 Gene [Source:MGI (curated);Acc:Spred2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15215689..15215752 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20840034..20840097 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80229975..80230038 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061589 (Dot1l) NM_199322 DOT1-like, histone H3 methyltransferase (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dot1l-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 93776157..93776220 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38323513..38323576 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 125823692..125823755 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37146027..37146090 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 91217082..91217145 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 16096381..16096444 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047213 (Ythdf3) NM_172677 YTH domain family 3 Gene [Source:MGI Symbol;Acc:MGI:1918850]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20202381..20202444 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031060 (Rbm10) NM_145627 RNA binding motif protein 10 Gene [Source:MGI (curated);Acc:Rbm10-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126843432..126843495 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001998 (Ap4e1) NM_175550 adaptor-related protein complex AP-4, epsilon 1 Gene [Source:MGI (curated);Acc:Ap4e1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74276930..74276993 60
NO GENE  


Sequence tag IST14238F9BBF2
Sequence
TTGGTGGCTCACAACCATCTGTAACAAGATCTGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59325710..59325743 34
NO GENE  

 
Come back to gene ENSMUSG00000001998


For any suggestions or comments, please send an email to unitrap@crg.es