Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13865C2
Clone ID IST13865C2
Vector VICTR74
Project tigm

Sequence tag IST13865C2HMF1
Sequence
GGACTATTGTAAGAAATACAGTCAAGAGTATGATTACCTTTCTGGGTATGGGCTCACAGATGGTACCTGGGCATCGAGGG
AGAGAAGGGGAAGAAAGATCTGGCATTGTTTTGTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI13711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45600884..45601002 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST13865C2BBF1
Sequence
GGACTATTGTAAGAAATACAGTCAAGAGTATGATTACCTTTCTGGGTATGGGCTCACAGATGGTACCTGGGCATCGAGGG
AGAGAAGGGGAAGAAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI13711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45600901..45601002 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es