Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13398C4
Clone ID IST13398C4
Vector VICTR74
Project tigm

Sequence tag IST13398C4BBF1
Sequence
ATACTAGTTACTATCTTAAGCTCTTTGTATGCATTAAATAATCTCATCCTCAATAATAATGCCNTGAAGTAGGCACTATT
ATTCTGAATTTAAAGATGANACCAAAAAACAAGTGAAAGTGTAAGCTGGGGGCACAGTGTANTGGTANTCNATAACAGCA
TTGATGACAGCATGCTGCAAGGACAAAGCTTCAACCCACAGAAATGTGCACGCANTAANCAAACTGTCCAANATCACCCA
NGCNGTGGCAGAACTGGGACTTTAAACCCAGGCAATCTGGCTCCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI19507

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116300618..116300907 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033439 (Ccdc76) NM_030016 coiled-coil domain containing 76 Gene [Source:MGI Symbol;Acc:MGI:1925219]


Sequence tag IST13398C4HMF1
Sequence
ATACTAGTTACTATCTTAAGCTCTTTGTATGCATTAAATAATCTCATCCTCAATAATAATGCCATGAAGTAGGCACTATT
ATTCTGAATTTAAAGATGAGACCAAAAAACAAGTGAAAGTGTAAGCTGGGGGCACAGTGTAGTGGTAGTCGATAACAGCA
TTGATGACAGCATGCTGCAAGGACAAAGCTTCAACCCACAGAAATGTGCACGCAGTAAGCAAACTGTCCAAGATCACCCA
GGCAGTGGCAGAACTGGGACTTTAAACCCAGGCAATCTGGCTCCANATCTAACCCTGGAACCTGCATTACGCTGCTTCTC
CC
Sequence Type genomic DNA
Unitrap ID UNI19507

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116300587..116300907 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033439 (Ccdc76) NM_030016 coiled-coil domain containing 76 Gene [Source:MGI Symbol;Acc:MGI:1925219]

 
Come back to gene ENSMUSG00000033439


For any suggestions or comments, please send an email to unitrap@crg.es