Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14299E10
Clone ID IST14299E10
Vector VICTR74
Project tigm

Sequence tag IST14299E10HMR1
Sequence
ATTTGAGTCTAGGCACTGATTATCCCATCTTTTTCCTGGANCCCTTAAACAAAAGAGTAACAAACTAATTTCTTTTACCT
GTAAAACAGTAATAATGTGCGCATTCACTTTATGGAAGACCCAGAAAGACTGTAAATGTANCACCCTGTCANTTANGCCT
TTTTTTTTTNNANNCC
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84837430..84837598 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14299E10BBF1
Sequence
AAATAAACACAAGGTTTTAAACTTACTTTTATAGGAATATGGCCTACTTAAAATATGGGGTGCATGAACAGCTAATGACC
AGGATAAGCTTGGCCAGGAAGCTGCTACGTGTTCAGCGGACGCCCAGCTCCACCAGTGCATTTCACCGGCACAACACATT
ATCTGAAGCCCACCCCCTGACAACCAAAACACTTGGAAAAAAAAAAAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84837225..84837433 209
NO GENE  


Sequence tag IST14299E10HMF1
Sequence
AAATAAACACAAGGTTTTAAACTTACTTTTATAGGAATATGGCCTACTTAAAATATGGGGTGCATGAACAGCTAATGACC
NGGATAAGCTTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84837337..84837433 95
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es