Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10890E6
Clone ID IST10890E6
Vector VICTR76
Project tigm

Sequence tag IST10890E6BBF1
Sequence
ATGGTGGCTCACAACCACCTGTAACAAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI29852 UNI30252 UNI30938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74764075..74764107 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 122383916..122383948 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4264826..4264858 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 41016898..41016930 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 41164931..41164963 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21456463..21456495 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81381792..81381824 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13119769..13119801 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20651051..20651083 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51383228..51383260 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55397096..55397128 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33296023..33296055 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037426 (Depdc5) NM_177786 DEP domain containing 5 Gene [Source:MGI (curated);Acc:Depdc5-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 137833038..137833070 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030852 (Tacc2) NM_001004468 transforming, acidic coiled-coil containing protein 2 Gene [Source:MGI Symbol;Acc:MGI:1928899]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86482519..86482551 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 90112889..90112921 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71172232..71172264 33
NO GENE  


Sequence tag IST10890E6HMF1
Sequence
ATGGTGGCTNACAACCACCTGTAACAAGATCTGATGCCCTCTTCTGGTGTGTCTGACNACAGCTACAGTGTACTTTCATA
TAATAATAAATAAATATTTTTAAAATTTNAAAAAACTGGCCCAANAGGTTTANGACANTGATANAACATATGTCTAGTAT
GATCAAGGTCCTTGTTTNGATGTTGANTNNGANGTGAACTACANAAAAACCAACCCCCAAAACCTTAAAACCAAATCCAA
ATGGCTGAAAAACATATTAAAAGGTTCTTANTGTTATGCCCCCCACCCCNAACTGCAAATCAAAACAGTGGAATANCACA
TTCNAATTACTANAATTGCTTAAATNNAANGGTANAANATAATTTGATTCTCCCTCTNATGATAATAGCNTANCNNNNGG
GCATGGTGGCACACGCCTTTAATCCCNGCACTNNNNANGCANANGCAGGCAGATTTCTGANTTCTANGCCAGCCTGGTGT
NCNGAGTGAGTTCCANGACANCCNNGGCTATNCNGANAANCCCTGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10890E6HMR1
Sequence
CATGTGGTTGCTGGGATTTGAACTCAGGACCTTCANAAGGGCAGTCAGTACTCTTAACAGTTGAGCCATTTCACCAGCCC
AGAATTTCATTTTTTTTGTATTATTGACCACAATTAATCATCTGGGTATAACAGTTCACCCAGACAGTCAATAAAAATAT
ATATATATATAAATAAATAANTCTTTGGACCAGAGTGAACNGGGATTGGGTGANCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 140766450..140766665 208
NO GENE  

 
Come back to gene ENSMUSG00000030852


For any suggestions or comments, please send an email to unitrap@crg.es