Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D047A12
Clone ID D047A12
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D047A12
Sequence
AGATAGGCTGATTTGGTTGGTGTCTTGCTCTTTCTGTGGGAAGGCTGCGGCTCACTTCCTTCTGACTTCTTGATAATTTT
GCATTAGACATTTAACTCTTCTTTCTATGATCTTTCCTTCTAGACACTGAGTTTTTTGGTTGTTGCCTAAAACCTTTTCA
GAAATCCCTTCCCTCGCCATCACACTGACATGAGTGTGGGTCTTCCTGGTCCCCACAGTTTGCCTAGTTCTGAGGAAGCA
TCGAATTCTGGGAACGCCTCATCAATGCCTGCAGTTTTTCATCCCGAGAACTATTCTTGCTTACAAGGGTCTGCTACTGA
GAAGCTCTGCACAGAGGCTG
Sequence Type mRNA
Unitrap ID UNI10653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122657612..122657951 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012396 (Nanog) NM_028016 Nanog homeobox Gene [Source:MGI (curated);Acc:Nanog-003]


SPLK-Sequence tag 3SD047A12
Sequence
TATACAGTTAGTTTGCAATTTGCCCAAATGGCCGTTTTCTCCAGCAGAAGCAGTTAGCATTTCTCTCAACCTTTGGGAAT
ATGGATGTCACTTAGCAGTTCTGGGTTTGTGAGCTCAGTGCTCCTTCCAAACCCCAAACAAGTGTACACAGTTTAAGTCA
TTCATTCTTATAGCTAGCATCTGGAGCCAAGGTCTGAAGCTCATTGTCTGTACAGAGTCAGCCCAGTACTCAGGCTTGTA
AATGGTAGAACCAAGAGGCTGCTAGGCTGTGTGTGCCACGGTGCTCAGGTGC
Sequence Type genomic DNA
Unitrap ID UNI10653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122658297..122658588 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012396 (Nanog) NM_028016 Nanog homeobox Gene [Source:MGI (curated);Acc:Nanog-003]

 
Come back to gene ENSMUSG00000012396


For any suggestions or comments, please send an email to unitrap@crg.es