Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10750D4
Clone ID IST10750D4
Vector VICTR76
Project tigm

Sequence tag IST10750D4HMR1
Sequence
NNANGAAAGANAAACTGTGTCNTAGATAGTTTAGAAAAGCCTCATGCAGCCCTCCAGTATTAAATTCTAAATATTTCCTT
CTGGGTAAAATCTAATAGATGAACAGGTACATGAAAGCATTTTTATTCTCAATCCGTTTCTTTAGCTTTCGTGCAGAGAT
GTCTATAAACTAGCTGTTGGTGAATAAGTACTTTTAAACGGGGANAAACACATTTAACTTTCAAAAGCTAAAATCCTGTA
ATTTATGTTCNCTGCCCANACNTTAAGATAAAATGCATTTGTGACTCANCNNGACNNTNNANTCCN
Sequence Type genomic DNA
Unitrap ID UNI6799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28536040..28536330 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]

 
Come back to gene ENSMUSG00000037640


For any suggestions or comments, please send an email to unitrap@crg.es