Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11028G6
Clone ID IST11028G6
Vector VICTR76
Project tigm

Sequence tag IST11028G6HMF1
Sequence
AGTAAATTTACAATGGGCATTCATATTACTTTATAATCCTCGTTTCTGCAACTGGTTACGTGGCCTTAATTGGTATTTAT
AACTACCTTCCTCTACTACCCATTCTGTATTTCCTTCACCTTCAGCCAGCACCTCAGCAGGTCTTGGCTCTTTTCCTGGA
GGATTGACCCATACCTTCATTCCTGATGGGTCTGCGTCCTTTGTCATCCTGCTTGGATTAGGCTGTTGTAGTTTCCCATT
GACTTTAATCACAGGACATGGTAGTACTAAGAGACGCCCTAAGGGATCTCCTGCACTCCAGACATAATCTTGCTTACCAC
CATTGTGAAGAGGTAATCCAATTTCCCCATGGTAATCTGGATCTATCACCCCTCCTAACACTGTTATTCCTTTTTTAGCC
TGTTGGTTNAAGGGCATTAGAAGCCCAAAATGACCAGGGGGAAGTCTGAGCTTCCAGTTCAATGANNTGTTTGTTGTANC
TCCTGGTN

Sequence Type genomic DNA
Unitrap ID UNI9273 UNI30944 UNI30945 UNI30946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17092943..17093429 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054366 (Prune2) prune homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4658657..4659143 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37576428..37576914 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31819458..31819944 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16879147..16879633 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 106499999..106500485 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9510955..9511441 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22296033..22296519 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20424239..20424725 479
 
EST/CDNA Est Name
  BU563801.1 - AV206190.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14976722..14977208 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 10938812..10939298 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7260577..7261063 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11071028..11071514 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19349618..19350104 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32977380..32977866 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 39595112..39595598 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30463585..30464071 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17871061..17871547 479
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3850617..3851103 479
 
EST/CDNA Est Name
  AI930322.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16612626..16613112 479
NO GENE  

 
Come back to gene AI930322.1


For any suggestions or comments, please send an email to unitrap@crg.es