Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D048B04
Clone ID D048B04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D048B04
Sequence
CGGCGGGGCAGAGGCGGAGGATCCTTCCTGTGTGGAAGCCGCAGATCCCGGTGAGCCCTCTCACCTGGCGCTCTCTCCAT
CCTCGGCGCGATAACCATGGCAGCAGGCTGCGAGGGCATCGCGCCCCCGACCCTGGGCGAGAGAACTGTGGGGGAGGAAG
Sequence Type mRNA
Unitrap ID UNI38

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35770472..35770625 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022849 (Hspbap1) NM_175111 Hspb associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913917]

 
Come back to gene ENSMUSG00000022849


For any suggestions or comments, please send an email to unitrap@crg.es