Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D048G04
Clone ID D048G04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D048G04
Sequence
CGCCACTCCCGGCTGCTTGGACTCTGCTAGTCCTTCTGGGATCCGCTCGGAGGGGACCCAACGCCTAG
Sequence Type mRNA
Unitrap ID UNI10847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45178504..45178571 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066705 (Fxyd6) NM_022004 FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]


SPLK-Sequence tag 5SD048G04
Sequence
GGACAGTGATTCTCATCAGTTGTGACAATACAGAGATGCTTCTAAGTGACTGGTGCGCAGGTAGGGGTAGTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD048G04
Sequence
TGTGTTGGCCAGAAGGTGACTCATGTTCTGCGGCAGGATGGATTGGGACAGTGAGAGATTTTACCATGATCTGTGTGCTA
TAAACTGTATGAATTATTTATTTCTGAGACTTCTCATTGAATAAGTTCAGACCACAGTTGGCAAAAAGCAATTGAATCCA
TAGAAAGTTAAGGAGAGGGGCTAGAGAGATGGCTCAGTGGTTAAGAGCACTGACTGCTTTTCCAAAGGTCCTGAGTTCAA
ATTTCAGCAACCACATGGTGGCTCACAACCATCTGTAATGAGATCCCACTAGTGTCGACACCAGCTCNAATTCAGCCACA
GTCTCTCCTAGCAACGNNTACTCTT
Sequence Type genomic DNA
Unitrap ID UNI10847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45194545..45194831 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066705 (Fxyd6) NM_022004 FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]

 
Come back to gene ENSMUSG00000066705


For any suggestions or comments, please send an email to unitrap@crg.es