Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14185G12
Clone ID IST14185G12
Vector VICTR74
Project tigm

Sequence tag IST14185G12HMR1
Sequence
GAATNNTTCATGCATCTCTGGGATGAAGCCTACTTGATCATTGTGGATGATGATGTTTTTGAA
Sequence Type genomic DNA
Unitrap ID UNI7052

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22056357..22056419 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]


Sequence tag IST14185G12HMF1
Sequence
ATTCAACATAGAAAAATTTCTCACTCTAATCCACCATATAAACAAACTGAAAGAAAAGGAAAGACCACATGATCATCTTA
TTAGATATTGAAAGGTCTTTGACAAAATCTAATAACCCTTCATGATAAAAATTTTAGAGAGACTGGGGATAAAACGGGCA
TACCTAAATATAAGAAAGGCAATTTACAGTAAGCCAAGCCAAACATTAAGGCTCCAATCTCATACAAACATCAGAGAACA
GAAAAGGTCAGATAGGTCCTGATGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22056097..22056360 264
NO GENE  

 
Come back to gene ENSMUSG00000027630


For any suggestions or comments, please send an email to unitrap@crg.es