Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10851E12
Clone ID IST10851E12
Vector VICTR76
Project tigm

Sequence tag IST10851E12HMF2
Sequence
CCTCAGTGGTGAAAGAATGAAAGTTTTTCTTCCAAGACTAGGTGCCACGGACTGGGCTCATTGGGCCCTCCTCAATCCAT
GCAAATCAAGGTCTCGGACAGATGGGCATAGAGTTGGTGGGCGTGGGGGTGACAAACAGACTGGACAGGAGAGACTATGT
TGAATCTGAGTGTAATTTGTCAAATCGAGCATCAAACTTTTTATACAGAAGAATAACAAGAAACCATGTGACATATCCGC
AGAGTTACAGTGACACAAAACATAANGAATGTATACNTCAAANGATGGCGGGAGGGGGCTGGTGAGATGGCTCANTGGTT
AAGAGCGCCAACTGCTCTTCCGAAGGTCCCGAGTTCAAATCCCAGCANCCACATGGTGGCACACAACCNTCCNTAATGAA
ATCTGATGCCCTTTNNTGGAGTATCTGANGAGAGCTACAGTGTACTTACATATAGNAAATAAATAAATCTTTAAAAAAAA
AAAAAAAN

Sequence Type genomic DNA
Unitrap ID UNI18577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27174628..27175114 465
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es