Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D003H08
Clone ID D003H08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D003H08
Sequence
TTCTTTCTTTGGGGGAAAGGCGTGAGGGAAGTACCCAACAGCAGCAGACTTTGAATCTTTAAACAGACAGGTCTGAGAGC
CCGAACTCTCCTTTTCCTTTGACTTCAGCCTCCAAGGAGTTCCACCACTTTGGCGTGCCGGCTTCACTTTCATTAAGTGA
AAGA
Sequence Type mRNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56097161..56097324 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]


SPLK-Sequence tag 3SD003H08
Sequence
CCCAAGAATGAGGCGGGGCGGAAGAAGGAGGGGCAAAGAAGACCCTTCGAGAAACCCTGCCATAGCTACTGACGTGTGCT
GAGGCAAATCCGTTCAGGATTGGGAAATTCAAACCTTGACTTCCGAGCAGAGTTCTCCCCGTGAGTGCCCTCGG
Sequence Type genomic DNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56098807..56098960 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]

 
Come back to gene ENSMUSG00000050953


For any suggestions or comments, please send an email to unitrap@crg.es