Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14997F11
Clone ID IST14997F11
Vector VICTR78
Project tigm

Sequence tag IST14997F11HMR1
Sequence
TTGTATACCTGCTTCTGTTGAGCACGTGCCTTCTCTGTCCCACTCAGGATGAAACGTCTGTGAGCAGTGAAGACTTTGAT
ATGAATGACTCCGCATGGATGTCAGCTGACCCCCACCTGGCCTCCAGCCTTAGCCCCAGCCAAGAGGAGAGGATGCGGAG
CCCACAGAACCTCCATAGCCAGGAGGATGGTGAGTGCCCCTTGGCAGCTGGCAGGGTGGGCCCTCATTGCCCTGTGAGTG
GCCTGCATGTGCCCTGGGTGGTGGGACCCAGGTGACACTTGTGGTTCCTGTTGTACTTGAAAGCTGGTGTTGTCAGCATC
TCTGCCATCTCCNCTGCCCNANANAGAGCANGCTGTTCTTTCATGCANANCCCN
Sequence Type genomic DNA
Unitrap ID UNI27663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153261758..153262130 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061411 (8430427H17Rik) NP_001127772 RIKEN cDNA 8430427H17 gene Gene [Source:MGI Symbol;Acc:MGI:1918765]


Sequence tag IST14997F11BBF1
Sequence
CAATGGGCCTGGGGACCCTTTTTAGCAGACTAGGAAGGGTCCCAGAGGGCACAGGGAGCCCCAAGAACGTGGAGTGAGTG
CTGAATGGTACTCTCCCTGACCTCCTGAAGTGGCTCGGGCTCTAGTTCCTGTCGGAAGCCAGGGTTAAGGGCTGGTGCTG
TCTGTAATTGANNACNNTTAANAGGTCTCACATCCTGTGGGGCANATNNCANANCATGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14997F11HMF1
Sequence
CAATGGGCCTGGGGACCCTTTTTAGCAGACTAGGAAGGGTCCCAGAGGGCACAGGGAGCCCCAAGAACGTGGAGTGAGTG
CTGAATGGTACTCTCCCTGACCTCCTGAAGTGGCTCGGGCTCTAGTTCCTGTCGGAAGCCAGGGTTAAGGGCTGGTGCTG
TCTGTAATTGAANACAATTAANAGGTCTCACATCCTGTGGGGCAGATAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153262128..153262335 204
NO GENE  

 
Come back to gene ENSMUSG00000061411


For any suggestions or comments, please send an email to unitrap@crg.es