Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D004B07
Clone ID D004B07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D004B07
Sequence
ACACCTCCACTCCCCAGAANACCAANNCCNNCCTCCCCCGNNAACAAAGACCCCTCTCGTGGTCAGGAGGCCGCAGCTCC
NNCTGGGCCACAGCTGCAGGTCCTTGACCCAAAGGAGAAGGCNNNCACGTTCTCAGCGTCTCTCCGGGGGAGGCATCTGN
NNCATCCTGNNNCAGAGCAACAGNNNGTGATCCAGAGGTTGCAGCCGGAGCAGGGGAGCCCAAAGAAGTGTGAAGCTGAA
GAGGCAGAGCCACCAGCTGCCACACAGCCTCAAACCTCAGAGACTCAGATCTCTCATCTGCCAGAATCAGAAAGGACTCA
TCACACTGT
Sequence Type mRNA
Unitrap ID UNI10852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55281005..55282633 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022185 (Acin1) NM_023190 apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

 
Come back to gene ENSMUSG00000022185


For any suggestions or comments, please send an email to unitrap@crg.es