Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12814D1
Clone ID IST12814D1
Vector VICTR76
Project tigm

Sequence tag IST12814D1BBF1
Sequence
AGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI20271 UNI30958

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132240831..132240879 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028886 (Eya3) NM_210071 eyes absent 3 homolog (Drosophila) Gene [Source:MGI (curated);Acc:Eya3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44562475..44562523 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032096 (Arcn1) NM_145985 archain 1 Gene [Source:MGI (curated);Acc:Arcn1-001]


Sequence tag IST12814D1HMR1
Sequence
CNNNGANTTTCTTGGCNTGAAAGAAAGCTCTCATCCNTGTATCATGTTCTCANANAGATACATGGGGATAGAACTCCTGC
CTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032096


For any suggestions or comments, please send an email to unitrap@crg.es