Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11105F11
Clone ID IST11105F11
Vector VICTR76
Project tigm

Sequence tag IST11105F11BBF1
Sequence
AATAAACAGGGTGTGCTCCGTGCTGCCTGGCCTCTCCCAGCCCCAGCGTTAACCCTTGCTGCCCTAGATAAATAGGCTTC
ACCCCAAAGATCATCCTCCGAGAGACGGGACCAGAAAGGTCCCGTCACGTGACCAGGAAGGTCCCATCACGTGACCACCT
TCCATCTGGTTAGGCTCAGGTCCCTGTGTCTTGGAGCACATGGGGCCAACTCTAGGTCACTGGGGTTCACACAGACTANT
NAGGCACCTCAGACTTTCTAATAAAATCTCCCCTGCCCGCCTCCTCACTCATTTTTGATCCGAGGGCTTTCTAGACCACT
CTAACCGGCCTTCTCTCATTTCCCGGAAGCCCAGTCCGAAAGAGAGTCTTCTATATTGTGTTTAGAGTCGTGAAGCCTGT
GAAGAANCAGCAGCCCTGTCATGGAAGCCCAACTAGTGTAGTCTGCATGCTGTGAGTGAGTGTGGGTAGTCCCAGGCATT
TCTGANACATCCCACTNNGATCT
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148220902..148221402 486
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST11105F11HMF1
Sequence
AATAAACANGGTGTGCTCCGTGCTGCCTGGCCTCTCCCAGCCCCAGCGTTAACG

Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148220902..148220954 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es